Transcriptional regulation of the Prevotella ruminicola recA gene

Rustam Aminov, K. Tajima, K. Ogata, T. Nagamine, M. Sugiura, Y. Benno

Research output: Contribution to journalJournal articleResearchpeer-review

62 Downloads (Pure)

Abstract

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents: mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma(70)) and B. subtilis (sigma(A)) consensus sequences, as well as to the recognition sites of other minor a-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.
Original languageEnglish
JournalCurrent Microbiology
Volume36
Issue number5
Pages (from-to)259-265
Number of pages7
ISSN0343-8651
DOIs
Publication statusPublished - 1998
Externally publishedYes

Keywords

  • Animals
  • Base Sequence
  • Binding Sites
  • DNA Footprinting
  • Gene Expression Regulation, Bacterial
  • Molecular Sequence Data
  • Prevotella
  • Rec A Recombinases
  • Rumen
  • SOS Response (Genetics)
  • Transcription, Genetic
  • EC 2.7.7.- Rec A Recombinases
  • messenger rna
  • article
  • bacillus subtilis
  • bacterial genetics
  • escherichia coli
  • gene sequence
  • genetic transcription
  • nonhuman
  • prevotella
  • priority journal
  • reca gene
  • transcription regulation
  • MICROBIOLOGY
  • ESCHERICHIA-COLI
  • NUCLEOTIDE-SEQUENCE
  • BACILLUS-SUBTILIS
  • DNA DAMAGE
  • MOLECULAR-CLONING
  • LEXA REPRESSOR
  • RUMINAL BACTERIA
  • EXPRESSION
  • INDUCTION
  • BACTEROIDES
  • gene regulation
  • SOS response
  • Anaerobic Gram-Negative Rods Eubacteria Bacteria Microorganisms (Bacteria, Eubacteria, Microorganisms) - Bacteroidaceae [06901] Prevotella-ruminicola anaerobic rumen bacterium
  • Bacillus subtilis sigma-A
  • Escherichia coli sigma-70
  • recA gene SOS-box-like regulatory sequence, expression, transcriptional start sites, transcriptional regulation
  • 10010, Comparative biochemistry
  • 10300, Replication, transcription, translation
  • 13014, Metabolism - Nucleic acids, purines and pyrimidines
  • 31000, Physiology and biochemistry of bacteria
  • 31500, Genetics of bacteria and viruses
  • Biochemistry and Molecular Biophysics
  • primer extension analysis analytical method, molecular genetic method
  • Molecular Genetics

Fingerprint Dive into the research topics of 'Transcriptional regulation of the Prevotella ruminicola recA gene'. Together they form a unique fingerprint.

Cite this